Questions

Do you think Unilever could have pursued the same

QUESTION Do you think Unilever could have pursued the same basic strategy 30 years ago? If not, why not, and what has changed to make it possible today?two paragraphs in lengthAPA format   ANSWER: REQUEST HELP FROM A TUTOR

Read full post

Date: September 2nd, 2020

ACCOUNTING-Focus your work on a report that reflects the purpose of the SAS

QUESTION Write a 3-4 page, double-spaced paper reflecting the research performed by you.Focus your work on a report that reflects the purpose of the SAS, analysis of the SAS, and provides a conclusion. At minimum, headings for the purpose, analysis, and conclusion sections of your paper are required.The purpose section should also include authoritative citations.The […]

Read full post

Date: September 2nd, 2020

ACCOUNTING-A company has $35 per unit in variable costs

QUESTION A company has $35 per unit in variable costs and $1,200,000 per year in fixed costs. Demand is estimated to be 102,000 units annually. What is the price if a markup of 40% on total cost is used to determine the price?   ANSWER: REQUEST HELP FROM A TUTOR

Read full post

Date: September 2nd, 2020

Devry MGMT410 Week 1 Discussion DQ 1 & DQ 2 Latest 2015 November

QUESTION DQ 1Human Resources Management (HRM)—what a mouthful! Class, this term, I will introduce you to the concepts of HRM—what it is, what it does (typically), what it can do (optimally), and what it should do (strategically). To start, let’s work on a few introductory questions.What purpose does HRM serve in an organization?What role does […]

Read full post

Date: September 2nd, 2020

Protein synthesis worksheet

QUESTION BIO1 Name: ________________________________ Protein Synthesis Worksheet You isolate the following piece of DNA from a unicorn hair found at a crime scene. 3’TACAAATATAGACCTATAGAAAGCGGGATCCCATTCTACTGGCAATACCGCCTCTACAAAACTCTTTCGTTGGCGCGTTACCCACTCGCCCGCGGCCTCACTGGGTACCCACTCGCCAGTTGCCGGGGGAGTTGCCCATA5’1. Write the corresponding second strand beneath the strand above. *Remember to include the polarity of the second strand! 2. The promoter and termination sequences for unicorns are as follows: Promoter sequence: […]

Read full post

Date: September 2nd, 2020

ACCOUNTING-Timothy purchased a new computer for his consulting practice

QUESTION Timothy purchased a new computer for his consulting practice on October 15th of the current year. The basis of the computer was $4,000. During the Thanksgiving holiday, he decided the computer didn’t meet his business needs and gave it to his college-aged son in another state. The computer was never used for business purposes […]

Read full post

Date: September 2nd, 2020

How do the blood volume, blood pressure, heart rate

QUESTION How do the blood volume, blood pressure, heart rate, and stroke volume change during septic shock?Scenario: T. J. and Tyler were building a treehouse.While searching for a board in apile of used lumber, T. J. stepped on arusty nail that penetrated deep into hisfoot, causing it to bleed. Neither T. J.nor Tyler wanted to […]

Read full post

Date: September 2nd, 2020

ACCOUNTING-Draw an entity relationship diagram for the following

QUESTION 7-14. Draw an entity relationship diagram for the following: Sales of inventory are made to customers by salespeople. After the sale, cash is received by cashiers.7-15. Draw an entity relationship diagram for the following: An accounting firm holds recruiting events for college students. At these events, recruiters are seeking students with particular skills.   […]

Read full post

Date: September 2nd, 2020