umuc biol320 full course latest october [ all weeks discussions and all assignments and course project and final exam

QUESTION

discussionsweek 1Week 1 Discussion.umuc.edu/d2l/img/lp/pixel.gif” alt=””>Actions for ‘Week 1 Discussion’.umuc.edu/d2l/img/lp/pixel.gif” alt=””>Subscribe.umuc.edu/d2l/img/lp/pixel.gif” alt=””>Hide DescriptionWeek 1 covers the following main concepts:definition of forensic biologycell biologybasic cell differencesscientific methodvalidationBased on the assigned reading, post an original response to the questions found below.What is forensic biology and how does it differ from one other discipline of forensic science? Examples of other disciplines of forensic science would include areas such as forensic anthropology, forensic odontology, crime scene investigation, forensic toxicology, forensic chemistry, trace evidence, firearms & toolmarks, etc..What is the difference between prokaryotes and eukaryotes?Describe the basic structure of a eukaryotic cell.List and describe each of the steps of the scientific method.How is data typically validated in forensic laboratories? Refer to the powerpoint and the FBI Quality Assurance Standards to help answer this question.You are not required to respond to your classmates for this conference. Be sure to correctly cite any material used in your responses that is not original. This conference is worth a total of 3 points.Your responses will be graded using the following scale:2 points: Detailed, original response provided for each of the questions. Reasoning is logical. Terms and concepts from the assigned materials are incorporated.1 point: Proper form is used (grammar, spelling, style). If applicable, correct and full citations for sources are used.Your responses are due by 11:59 pm on Sunday.week 2Post an original response to the following questions. Use appropriate references when necessary. Provide a thoughtful response to at least one other classmate. You may need to rely heavily on the week 2 powerpoint to answer these questions. You will have until Sunday at 11:59 pm to respond.1. A great deal of fingerprint examination has been considered subjective. Based on the lab standard operating procedures, individual examiners will use their training and expertise to evaluate all of the information available in a fingerprint to decide whether there is a “match” or not. There is no set number of points that must be met. Do you agree with this method? Explain why or why not.2. Based on the formula used in the powerpoint, calculate the amount of 100 proof alcohol it would take for you personally to become “legally drunk” in the state of Maryland. The limit in Maryland is 0.08%. You can use a fake weight if you don’t want to expose how much you weigh to everyone :). Show your work.3. Two very important components to forensic serological analyses are the sensitivity and specificity of the test being used. Describe the difference between sensitivity and specificity. Do you think one is more important than the other? Explain why or why not.4. You are processing a sexual assault case. The suspect allegedly attempted to force another individual to perform oral sex on him. Upon arrest, the suspect defecated on himself. His underwear were submitted for testing. The investigators have requested amylase testing to corroborate or refute the suspect’s claim. Would you perform amylase testing in this case? Explain why or why not.Your responses will be graded using the following scale:2 points: Detailed, original response provided for each of the questions. Reasoning is logical. Terms and concepts from the assigned materials are incorporated.0.5 point: Proper form is used (grammar, spelling, style). If applicable, correct and full citations for sources are used.0.5 point: Thoughtful response to at least one other classmate.week 3Considering what you have read this week, compare and contrast the various methods for determining time since death. What do you consider to be the most reliable method of determining time since death? Be sure to include in your answer the reasoning behind your choice. Try to include something in your answer from each chapter from the reading. Please keep your answers to 1-3 paragraphs.Use appropriate references when necessary. Provide a thoughtful response to at least one other classmate. You will have until Sunday at 11:59 pm to respond.Your responses will be graded using the following scale:2 points: Detailed and original response. Reasoning is logical. Terms and concepts from the assigned materials are incorporated.0.5 point: Proper form is used (grammar, spelling, style). If applicable, correct and full citations for sources are used.0.5 point: Thoughtful response to at least one other classmate.week 41. As an expert witness, part of our job is to break down complex ideas when testifying so that a jury of individuals who may have little or no knowledge of science can easily grasp what we are saying. The polymerase chain reaction is a concept that DNA experts are often asked to explain in court. For a moment, pretend you are an expert witness in a trial. How would you explain PCR to a jury? Remember, you are explaining it to a jury (with a potentially short attentive span because they are tired and hungry) so your response should be brief, yet clear and effective. Creative analogies are encouraged.2. Occasionally, there can be mutations in DNA due to replication errors, transposable elements, or environmental hazard exposure. Discuss the different types of mutations possible (base pair substitution, insertion, deletion). What is an example of when a mutation could be harmful to an individual? What is an example of when a mutation could be beneficial?3. Do you feel that cloning should be allowed in the US? Why or why not? Support your answer with examples. Note: Remember some feel stem cell research is a form of cloning.Use appropriate references when necessary. Provide a thoughtful response to at least one other classmate. You will have until Sunday at 11:59 pm to respond.Your responses will be graded using the following scale:2 points: Detailed and original response. Reasoning is logical. Terms and concepts from the assigned materials are incorporated.0.5 point: Proper form is used (grammar, spelling, style). If applicable, correct and full citations for sources are used.0.5 point: Thoughtful response to at least one other classmateweek 5Compare and contrast the following DNA analysis techniques: STRs, miniSTRs, mtDNA (mitochondrial DNA), and Y-STRs. Do you believe that one technique is superior to any of the other ones? Discuss why or why not.Use appropriate references when necessary. Provide a thoughtful response to at least one other classmate. You will have until Sunday at 11:59 pm to respond.Your responses will be graded using the following scale:2 points: Detailed and original response. Reasoning is logical. Terms and concepts from the assigned materials are incorporated.0.5 point: Proper form is used (grammar, spelling, style). If applicable, correct and full citations for sources are used.0.5 point: Thoughtful response to at least one other classmate.week 6. Everyone is aware that additional training will occur at your new forensic lab, even if you are fully trained from an outside lab. This is part of the ASCLD-LAB (American Society of Crime Lab Directors – Laboratory Accreditation Board) accreditation. As part of that continuing education, you will be required to take 2 external proficiency tests per year. Please explain why you think this process is important and how it could benefit you while testifying on the stand as an expert witness.2. Ethics is important in several careers but can be devastating in forensics. One violation of ethics and a good attorney will have your career in ruins. Please consider the scenarios below. Choose ONE and explain your answer.If you know your co-worker has falsified some data on a case that you both completed analysis on, would you report it to your supervisor?You arrive at a crime scene and find out it is the house of your wife’s ex-husband and you have a long history of conflict in the past five years. Is it ethical for you to continue on the case?The defense attorney made a mistake in defending the case on a DNA data and would lose the case for sure. Do you have an obligation to correct him?Use appropriate references when necessary. Provide a thoughtful response to at least one other classmate. You will have until Sunday at 11:59 pm to respond.Your responses will be graded using the following scale:2 points: Detailed and original response. Reasoning is logical. Terms and concepts from the assigned materials are incorporated.0.5 point: Proper form is used (grammar, spelling, style). If applicable, correct and full citations for sources are used.0.5 point: Thoughtful response to at least one other classmate.week 71. Discuss your support or non-support of forensically maintained DNA databases including specific examples that will support your position. Your discussion should include your view on the convicted offender DNA databases, arrestee DNA databases, and whether DNA should be collected at birth for all US citizens. For more information regarding CODIS, you can visit this site: http://www.fbi.gov/about-us/lab/codis/codis-and-ndis-fact-sheet.2. You were assigned this article: .umuc.edu/d2l/common/dialogs/quickLink/quickLink.d2l?ou=69222&type=content&rcode=UMUC-670665″>Digital Forensics.umuc.edu/d2l/common/dialogs/quickLink/quickLink.d2l?ou=69222&type=content&rcode=UMUC-570701″>Please post an interesting (or important) fact that you learned from reading your assigned article. Post a response toTWO classmates (one in group 1 and someone in group 3).You will have until Sunday at 11:59 pm EST to respond. Your responses will be graded using the following scale:2 points: Detailed and original response. Reasoning is logical. Terms and concepts from the assigned materials are incorporated. Proper form is used (grammar, spelling, style). If applicable, correct and full citations for sources are used.1 point: Thoughtful response to two other classmates.week 71. Discuss your support or non-support of forensically maintained DNA databases including specific examples that will support your position. Your discussion should include your view on the convicted offender DNA databases, arrestee DNA databases, and whether DNA should be collected at birth for all US citizens. For more information regarding CODIS, you can visit this site: http://www.fbi.gov/about-us/lab/codis/codis-and-ndis-fact-sheet.2. You were assigned this article: .umuc.edu/d2l/common/dialogs/quickLink/quickLink.d2l?ou=69222&type=content&rcode=UMUC-670666″>Microbial Forensics.umuc.edu/d2l/common/dialogs/quickLink/quickLink.d2l?ou=69222&type=content&rcode=UMUC-570701″>Please post an interesting (or important) fact that you learned from reading your assigned article. Post a response to TWO classmates (one in group 1 and someone in group 2).You will have until Sunday at 11:59 pm EST to respond. Your responses will be graded using the following scale:2 points: Detailed and original response. Reasoning is logical. Terms and concepts from the assigned materials are incorporated. Proper form is used (grammar, spelling, style). If applicable, correct and full citations for sources are used.1 point: Thoughtful response to two other classmates.BIOL 320Homework #11.The two most important components of a cell for forensic DNA purposes are the and the .2. A cell that contains a nucleus is called cell.3. DNA and RNA are structurally similar; however, the only difference between the two is the lack of in DNA.4. When proteins are heated they lose their5. is the component of fecal matter that is used in forensic serological testing utilizing the _________ test.6. When evaluating the ability of a presumptive test two factors must be considered. __________ and ____________.7. is the component of urine that is used in forensic serological testing utilizing the _________________ test.8._______________ is the component of blood that is used in forensic serological testing. One type of presumptive blood test is called .9. Amylase’s ability to break down ___________ _____ allows the Phadebas test to be utilized as an effective presumptive test for the presence of saliva.10. is one of the components of seminal fluid used in forensic serological testing.WORD BANK:Acid PhosphataseKastle-Meyer (Phenolphthalein) TestGolgi bodiesRibosomesSensitivityJaffeProkaryoticOxygenStarchFunctionIronUrobilinogenNucleusCredibilityEdelman’sSpecificityStrengthMitochondriaCreatinineEukaryoticCytoplasmHemoglobinMoleculeUnicelluarhomework 2BIOL 320Homework #21. What does PCR stand for (1 pt)?2. List AND describe the three main steps of PCR (6 points)?PCR amplifies a specific gene from essentially a signal copy of DNA.3. Adenine bonds with ____________________ (1 pt).4. Cytosine bonds with _______________ (1 pt).5. True of False. Uracil is a nucleotide found in DNA (1 pt).BIOL 320Quiz #11. The scientific method comes in various forms. The book shows one version, and in my lecture notes, I presented another version. Despite variations, the core elements are always present. Which of the following would not be considered a core element of the scientific method?a. observationb. hypothesisc. questiond, experimente. conclusion2. Fill in the blank: Mitosis results in _______2___ daughter cells and meiosis results in____4_____ daughter cells.3.What is the difference between the cause and manner of death?a. The cause of death is the biological reason for the cessation of life while the manner of death is the way death occurred.b. The cause of death is the way death occurred and the manner of death is the biological reason for life cessation.c. The cause of death is a doctors term and is no different from the coroners term of manner of death.d. The term cause of death is used in hospital autopsy and manner of death in medico-legal autopsy.4. Which of the following does not belong?a. homicideb. drug overdosec. suicided. naturale. accidental5. Which of the following is incorrectly matched? (multiple select)a. livor mortis: post-mortem coolingb. rigor mortis: muscle stiffeningc. algor mortis: post mortem blood settlingd. petechiae: pin point hemorrhages6. True or False: Petechiae are a conclusive way to determine death by hanging or strangulation.7. Transcribe the following DNA template strand into mRNA:AAGTACGTAAGCTGGATATT8. True or False. An autopsy is required if a firefighter dies in the line of duty in Maryland.9. Which of the following components is most commonly tested for in forensic laboratories today to indicate the presence of fecal matter?a. creatinineb. amylasec. urobilinogend. urea10. True or False. Necrophagous means live-flesh eating.11. What are the two types of amylase? How do they differ?Amy 1 “salivary locus “responsible for amylase detected in saliva, sweat, nasal secretions, breast milk. Amy2 on the other hand “pancreatic locus”. It is responsible for amylase detected in semen, blood, urine feces, and vaginal fluid.12. A positive result with the Jaffe Reaction turns deep orange colo13. What are the main components of a sperm cell?Head, neck, acrosome, nucleus, mid-piece, and tail.14. True or False. A presumptive test can definitively identify a biological fluid.15. Name a confirmatory test for blood.Crystalline test16. Submit to your assignments folder with your name in the filename.BIOL 320 Quiz #2You are reviewing the Quantifiler results after running a real time PCR (RT-PCR) assay. Sample 1 crossed the threshold after 24 cycles. Sample 2 crossed the threshold after 29 cycles. Without considering any factors such as degradation, which sample likely has more DNA?Three sequential bases in mRNA are called a ___Which of the following shows a short tandem repeat (STR)?AATG GAT ACTA GTAGC AATG GAT ACTA GTAGC AATG GAT ACTA GTAGCAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGWhat would be the allele value (DNA type) for that short tandem repeat sequence?The four nucleotides of DNA are:The three main steps of STR DNA analysis are:True/false: YSTRs are maternally inherited.True/False: Nuclear STRs are only paternally inherited.True/False: miniSTRs are paternally and maternally inherited.final examBIOL 320 Final ExamThe written take home final examination represents the final assessment for this class. This exam is worth 26 points. Failure to submit this timed final exam document to your assignment folder within the time period will result in your exam not being accepted.Use of your, notes, or other resources is strongly discouraged.1. Place the parts of the scientific method in the best order (0.5 pt).2. A validation procedure must be . (1.5 pts)3. In a Punnett square, the letters that line the outside of the box represent (0.5 pt):a. Offspring genotypesb. Parental genotypesc. Gametesd. Offspring phenotypes4. Fill in the following Punnett square (0.5 pt):AbAAAAbbAbbbUsing the Punnett square above, if AA=brown eyes, Ab= hazel eyes, and bb= green eyes, there is a 50% chance the offspring of these parents will have what color eyes (0.5 pt)?a. Brownb. Hazelc. Green5. True/False: Fingerprints are developed during the early stages of fetal development. (0.5 pt)6. Latent fingerprints are composed of the sweat and oils of the body that are transferred from the ridge pattern to some substrate where they persist for some time until found by one of numerous visualizing techniques. (0.57. How many permanent teeth are typically found in a human mouth (0.5 pt)?a. 18b. 32c. 30d. 368. Which of the following is a use of forensic entomology? (0.5 pt)a. Obtaining human DNA from the victim’s flesh digested by the insect.b. Determining the cause of death.c. Calculating the PMI.d. Determining the quantity of ingested toxins and drugs from the analysis of insect body parts.e. All of the above.f. None of the above.9. Which of the following is not a characteristic of rigor mortis? (0.5 pt)a. Upon death, the membranes of muscle cells become more permeable to calcium ions.b. Rigor mortis first starts with small muscles in the face and these muscles are the last to relax after several days.c. The rate of rigor mortis is independent upon the victim’s activity and the victim’s age.d. Rigor mortis in and of itself cannot always be a reliable predictor of time since death.10. Unless the manner of death can not be determined, a forensic pathologist will usually declare one of the following as the manner of death. (2 pts)11. Briefly describe how the phenolphthalein reaction works. (0.5 pt)12. True/False: Amy2 is the “Salivary Locus” responsible for amylase detected in saliva, sweat, nasal secretions, breast milk, and Amy1 is the “Pancreatic Locus” responsible for amylase detected in semen, blood, urine, feces, and vaginal fluid. (0.5 pt)13. True/False: Beta amylase is the type of amylase that is found in plants. (0.5 pt)14. __________________ cells contain a nucleus. (0.5 pt)a. Prokaryoticb. Red bloodc. Eukaryoticd. Mitochondrial15. The two most important organelles in forensic DNA analysis are and the (1 pt).16. Describe DNA for a jury (In other words keep it SHORT and SIMPLE! It’s 11:30 am and they just put you on the stand. I’m a bored juror with a high school education and I’m hungry! 1 pt).17. Humans have ___23___ pairs of chromosomes. (0.5 pt)a. 23b. 28c. 46d. 2118. Match the type of DNA with the mode of inheritance (2 pts, mode of inheritance can be used more than once).19. DNA is a (0.5 pt):a. Lipidb. Proteinc. Carbohydrated. Polymer20. Which of the following base pairs is incorrect (0.5 pt)?a. G-Cb. C-Ac. A-Td. T-A21. True/False: DNA is single stranded and RNA is double stranded. (0.5 pt)22. Transcribe the following DNA sequence into mRNA (0.5 pt):5’-TACGATTGCTATGCCATC-3’3’-AUGCUAACGAUACGGUAG-5’final projectResearch ProjectAddresses Course Outcomes· recognize and apply the scientific method to forensic evidence to make decisions and solve problems· synthesize and apply forensic science knowledge and methods to evaluate evidence and perform casework· effectively communicate forensic information in an ethical manner to legal and other stakeholders for application in legal processes, publications, and policy decisionsThe Research Project has two parts: (1) Your final research project submitted to the Week 8 conference and to your Assignment folder and (2) Submission to Conference Week 8 and comments to the Research Projects of at least 2 classmates. Comments should adhere to the expectations about conference discussions described in the syllabus above.The Final Research Project can be presented in a variety of formats. You will be free to choose whether you will create a:Powerpoint with fully detailed narration (detailed text in the Notes section that include citations). The Powerpoint presentation could be based on a case study or crime scene investigation, or be based on any of the topics provided below. The PowerPoint presentation must also meet the Research Paper criteria discussed below.Case StudyCrime Scene InvestigationInformational websiteTraining document for investigatorsCommunication report to stakeholdersInvestigative Report for a fictional newspaperEducational materials to be used by high school teachers (includes lecture notes for the teacher and hands-on learning activities for high school students)Public service announcement to inform the public about one of the topics below (provide all the text and reference sources; must still meet all the criteria for the paper described below)In addition to depth of knowledge of the subject matter, your paper will be evaluated for clarity, proper sentence and paragraph structure, and proper resource citation. Please see the writing resources listed above in the syllabus and also check with the Effective Writing Center (EWC) if you need additional assistance.Reference citations must be provided in APA format. Check with the UMUC Effective Writing Center (EWC) if you require help with this format. There should be a minimum of 10 references and at least three of them **must** be original, primary research articles. The original research references (publications) may come from the journals, Journal of Forensic Sciences, Forensic Science International, or other peer-reviewed sources.A General overall Forensic Information Sources Link: HYPERLINK “.library.ucsb.edu/istl/03-spring/internet.html”>http://www.library.ucsb.edu/istl/03-spring/internet.html” http://www.library.ucsb.edu/istl/03-spring/internet.htmlThe Following are Suggested Topics for Research Investigation for the Forensic Biology 320 Research Project:Novel topics in forensic biology are welcome! Novel topics must be first approved by your instructor by the third week of the course.Forensic Biology Databases (Thoroughly, Research one of the following: Including CODIS, STRbase, mtDNAdatabases, Y-STR Databases, Fingerprint Databases, Hair Databases, Biometric Databases, Facial Recognition/Databases, Iris Recognition/Databases, Voice Recognition/Databases, Forensic Information or Interactive Databases).National Academy of Sciences Report: Strengthening Forensic Science in the United States: A Path Forward.(Thoroughly research this report and it’s recommendations for the forensic field, then include your opinion of whether or not an independent government agency should be formed, the National Institute of Forensic Sciences). Link:HYPERLINK “http://books.nap.edu/openbook.php?record_id=12589&page=281″http://books.nap.edu/openbook.php?record_id=12589&page=281Forensic Serology Testing. Detailed study of serological testing and applications.Forensic Botany. We don’t cover this in class, but it is certainly a valid forensic field of study.Forensic Entomology. Forensically relevant studies of insects, such as post mortem interval, detection of human DNA from certain insects, such as mosquitos, lice, ticks etc.Fish and Wildlife applications of Forensics: Novel applications and methods used in Fish and Wildlife cases.Animal Forensics: Forensic DNA Identification of domestic animals.Forensic Hair Analysis. Forensic Hair comparisons and studies.Forensic DNA Analysis. Short Tandem Repeat (STR) New Developments, Single Nucleotide Polymorphism (SNP) used in Forensics, mitochondrial DNA analysis (mtDNA) new developments, X chromosomal STR’studies and Y chromosomal STR studies. HYPERLINK “http://www.cstl.nist.gov/strbase/” http://www.cstl.nist.gov/strbase/Microbial Forensics. Forensic studies related to microorganisms.Forensic Toxicology. New methods and applications, Forensic testing of designer/synthetic drugs. HYPERLINK “http://home.lightspeed.net/~abarbour/vlibft.html” http://home.lightspeed.net/~abarbour/vlibft.htmlForensic Pathology. Medical Examiners, Death Investigations. Forensic Pathology novel findings in cases.Forensic Biology Validation Studies: Research on validation studies done for a particular subject in Forensic Biology, e.g. DNA, fingerprints, etc.You are expected to submit a Final version of this Research Project to the Week 8 conference at the beginning of Week 8 and to your Assignment Folder. Use the Research Assignment Calculator to track the development of your research project to help ensure that you will complete it in time for submission at the beginning of Week 8.· recognize and apply the scientific method to forensic evidence to make decisions and solve problems· synthesize and apply forensic science knowledge and methods to evaluate evidence and perform casework· effectively communicate forensic information in an ethical manner to legal and other stakeholders for application in legal processes, publications, and policy decisionsThe written take home final examination represents the final assessment for this class. This exam, which is non-proctored, will be provided by your instructor on a specified date and time. You will have 48 hours from the time that this exam is made available to complete and submit your time final exam. Failure to submit the timed final exam document to your instructor within the 48-hour time period will result in your exam not being accepted. Use of your textbook, notes, or other resources is strongly discouraged. The final exam may consist of multiple choice, fill-in-the-blank, short answer, and essay questions. 

 

ANSWER:

REQUEST HELP FROM A TUTOR

Expert paper writers are just a few clicks away

Place an order in 3 easy steps. Takes less than 5 mins.

Calculate the price of your order

You will get a personal manager and a discount.
We'll send you the first draft for approval by at
Total price:
$0.00