Protein synthesis worksheet
QUESTION
BIO1 Name: ________________________________ Protein Synthesis Worksheet You isolate the following piece of DNA from a unicorn hair found at a crime scene. 3âTACAAATATAGACCTATAGAAAGCGGGATCCCATTCTACTGGCAATACCGCCTCTACAAAACTCTTTCGTTGGCGCGTTACCCACTCGCCCGCGGCCTCACTGGGTACCCACTCGCCAGTTGCCGGGGGAGTTGCCCATA5â1. Write the corresponding second strand beneath the strand above. *Remember to include the polarity of the second strand! 2. The promoter and termination sequences for unicorns are as follows: Promoter sequence: AATATAGACCTATAGAA Terminator sequence: CCGGGGGAGTTGCCCWrite the pre-Â‐mRNA transcript sequence below. *Remember the polarity! 3. What are the three post-Â‐transcriptional modifications eukaryotes do to convert a pre-Â‐mRNA to an mRNA transcript? 4. Unicorn genes use the following introns: Intron 1: AUGGCGGAGAUGUUUUGAIntron 2: AUGGGUGAGCGGWrite the mRNA transcript below remembering to remove the introns. Spring 2014 1 BIO 1 5. Beginning with the start codon, translate the mRNA transcript and write the amino acid sequence below. Label the N and C-Â‐terminus of the polypeptide. 6. Describe the process by which a ribosome assembles amino acids to form a protein. (Describe the three steps of translation). 7. How many molecules of water were released in the synthesis of the above protein? 8. Below is a list of known unicorn genes and their variants. What can you tell about the missing unicorn? MET-Â‐THR-Â‐ASN-Â‐ASP-Â‐GLU-Â‐GLN-Â‐TRP-Â‐PHE-Â‐TYR-Â‐VAL-Â‐STOP MET-Â‐THR-Â‐ASP-Â‐ASN-Â‐GLN-Â‐GLU-Â‐TRP-Â‐PHE-Â‐TYR-Â‐VAL-Â‐STOP MET-Â‐THR-Â‐PRO-Â‐PHE-Â‐HIS-Â‐GLU-Â‐ALA-Â‐ARG-Â‐LEU-Â‐GN-Â‐STOP MET-Â‐THR-Â‐PHE-Â‐PRO-Â‐HIS-Â‐GLN-Â‐ARG-Â‐ARG-Â‐ILE-Â‐GLY-Â‐STOP MET-Â‐THR-Â‐SER-Â‐THR-Â‐ASP-Â‐VAL-Â‐ALA-Â‐ASP-Â‐VAL-Â‐ASN-Â‐STOP MET-Â‐THR-Â‐SER-Â‐TYR-Â‐ASN-Â‐VAL-Â‐ALA-Â‐ASN-Â‐VAL-Â‐ASP-Â‐STOP MET-Â‐THR-Â‐VAL-Â‐GLU-Â‐SER-Â‐ASN-Â‐ARG-Â‐ALA-Â‐ALA-Â‐PRO-Â‐GLU-Â‐STOP MET-Â‐THR-Â‐VAL-Â‐GLU-Â‐SER-Â‐ASP-Â‐ASN-Â‐ALA-Â‐VAL-Â‐PRO-Â‐GLU-Â‐STOP MET-Â‐CYS-Â‐PRO-Â‐LEU-Â‐LEU-Â‐LEU-Â‐THR-Â‐GLY-Â‐ASN-Â‐LYS-Â‐PRO-Â‐STOP MET-Â‐CYS-Â‐PRO-Â‐ILE-Â‐LEU-Â‐LEU-Â‐TYR-Â‐GLU-Â‐ASN-Â‐LYS-Â‐PRO-Â‐STOP Short ears Long ears Long legs Short legs Long fur Short fur Short snout Long snout Darker fur Lighter fur Spring 2013 2
ANSWER:
Expert paper writers are just a few clicks away
Place an order in 3 easy steps. Takes less than 5 mins.